AWANS INFORMACJE Dla nauczyciela Dla ucznia LOGOWANIE


Katalog

Katarzyna Skurska, 2014-05-26
Kielce

Biologia, Sprawdziany i testy

Sprawdzian - genetyka

- n +

1. Wytłumacz pojęcie „komplementarność zasad”.
2. Podaj liczbę poszczególnych nukleotydów we fragmencie cząsteczki DNA zbudowanym z 320 nukleotydów i zawierającym 90 nukleotydów z guaniną. Przedstaw i wyjaśnij sposób obliczenia.
a) nukleotydy adeninowe b) nukleotydy tyminowe c)nukleotydy cytozynowe
3. Wyjaśnij określenie „replikacja semikonserwatywna”
4. Rysunek przedstawia widełki replikacyjne DNA.
Dorysuj do schematu widełek powstającą w wyniku replikacji
nić wiodącą i nić opóźnioną założoną z trzech fragmentów Okazaki.
Opisz rysunek, oznacz końce 3' oraz 5' wszystkich nici.
5. Uporządkuj wymienione niżej struktury według rosnącego stopnia kondensacji DNA i zapisz je w odpowiedniej kolejności:
solenoid, DNA, chromosom, nukleonom, fibryla chromatynowa.
6. Wśród poniższych stwierdzeń wskaż jedno, które zawiera błędną informację o cyklu komórkowy.
Uzasadnij swój wybór.
A. w interfazie zachodzi replikacja DNA czyli podwojenie liczby cząsteczek DNA.
B. W profazie I pojawiające się chromosomy dobierają się parami, tworząc biwalenty.
C. Zjawisko crossing-over zachodzi w metafazie I .
D. Mejozę nazywamy podziałem redukcyjnym, ponieważ redukuje o połowę liczbę chromosomów
w komórkach potomnych
7. Rysunki przedstawiają fazy podziału mitotycznego komórek.
a) Uporządkuj rysunki we właściwej kolejności
b) Wymień po kolei fazy mitozy.
8. Korzystając z tabeli kodu genetycznego, podaj nazwy aminokwasów, które powinny być transportowane przez tRNA z antykodonem o sekwencji:
a) UGU, b) CGG, c) ACA
a) ……………………... b)………………………… c) …………………………
9.W cytoplazmie znajduje się mRNA o następującej sekwencji nukleotydów:
AUGCCAAUAGGUGCCUGGUUC

a) zapisz sekwencję nukleotydów w dwuniciowym DNA, na którym zaszedł proces transkrypcji podanego odcinka mRNA
DNA: .......................................
b) podaj, z ilu aminokwasów zbudowany będzie łańcuch peptydowy powstały w wyniku translacji tego fragmentu mRNA .....................................
c) korzystając z tabeli kodu genetycznego, określ skład aminokwasowy tego peptydu powstałego
po translacji
10. U organizmów eukariotycznych końcowy produkt transkrypcji czyli mRNA jest prawie zawsze krótszy od przepisywanego odcinka DNA. Wyjaśnij dlaczego.
11. Opisz rolę wymienionych kwasów nukleinowych w procesie syntezy białka.
a) DNA b) mRNA c) tRNA
12. Kwasy nukleinowe DNA i RNA są kluczowymi związkami w życiu wszystkich komórek.
Wskaż dwie wspólne cechy w budowie tych kwasów.
13. Wskaż dwa błędne zdania dotyczące kodu genetycznego i zaproponuj ich korektę.
a) kod genetyczny jest trójkowy, to znaczy że trzy kolejne nukleotydy kodują jeden aminokwas.
b) kod jest jednoznaczny, co oznacza, że jeden kodon wyznacza kilka aminokwasów.
c) kod jest specyficzny gatunkowo, co oznacza że każdy gatunek ma swój własny niepowtarzalny sposób zapisu informacji genetycznej
d) kod jest zdegenerowany, co oznacza, że jeden aminokwas może być wyznaczony przez kilka różnych kodonów
14. Uporządkuj wymienione niżej procesy zgodnie z ich kolejnością przebiegu podczas biosyntezy białka.
a) Przemieszczanie się nici mRNA z jądra komórkowego do cytoplazmy
b) Synteza mRNA na podstawie informacji zawartej w DNA
c) rozpad rybosomy i uwolnienie cząsteczki polipeptydu
d) powstanie kompleksu złożonego z nici mRNA oraz rybosomy
e) transport aminokwasów za pomocą tRNA do rybosomów
15.Kod genetyczny jest trójkowy. A GCU alanina
Nazwij dwie cechy kodu genetycznego przedstawione
na ilustracjach. GCU
B alanina GCC
GCA

16.Nazwij procesy zachodzące w komórce, oznaczone cyframi od 1 do 3 oraz podaj ich lokalizację w komórce

DNA pre-mRNA mRNA białko

DNA DNA mRNA białko
DNA

17.Porównaj DNA i RNA uwzględniając trzy kryteria dotyczące ich budowy. Skonstruuj odpowiednią tabelę.


Zgłoś błąd    Wyświetleń: 2755


Uwaga! Wszystkie materiały opublikowane na stronach Profesor.pl są chronione prawem autorskim, publikowanie bez pisemnej zgody firmy Edgard zabronione.


BAROMETR


1 2 3 4 5 6  
Oceń artukuł!



Ilość głosów: 0

Serwis internetowy, z którego korzystasz, używa plików cookies. Są to pliki instalowane w urządzeniach końcowych osób korzystających z serwisu, w celu administrowania serwisem, poprawy jakości świadczonych usług w tym dostosowania treści serwisu do preferencji użytkownika, utrzymania sesji użytkownika oraz dla celów statystycznych i targetowania behawioralnego reklamy (dostosowania treści reklamy do Twoich indywidualnych potrzeb). Informujemy, że istnieje możliwość określenia przez użytkownika serwisu warunków przechowywania lub uzyskiwania dostępu do informacji zawartych w plikach cookies za pomocą ustawień przeglądarki lub konfiguracji usługi. Szczegółowe informacje na ten temat dostępne są u producenta przeglądarki, u dostawcy usługi dostępu do Internetu oraz w Polityce prywatności plików cookies.
Dowiedz się więcej.