AWANS INFORMACJE FORUM Dla nauczyciela Dla ucznia LOGOWANIE


Katalog

Grażyna Denicka, 2011-05-17
Biała Podlaska

Biologia, Konspekty

Konspekt lekcji biologii dla klasy II LO - Budowa i replikacja DNA

- n +


KONSPEKT LEKCJI BIOLOGII
DLA KLASY II LICEUM OGÓLNOKSZTAŁCĄCEGO


TEMAT LEKCJI : Budowa i replikacja DNA .

1. Cele edukacyjne :

Po lekcji uczeń potrafi :
a) Wiadomości :
- zdefiniować terminy : nukleotyd , replikacja DNA
- wymienić składniki chemiczne budujące DNA
- opisać budowę przestrzenną DNA
- podać lokalizację DNA na terenie komórki
- opisać przebieg replikacji

b) Umiejętności :
- Określić biologiczną rolę DNA
- Określić , na czym polega komplementarność nici w cząsteczce DNA
- Skonstruować model DNA

c) Postawy i przekonania :
- Zdawać sobie sprawę , że prawidłowa informacja genetyczna jest warunkiem zdrowia
- umieć pracować z tekstem podręcznika

2. Środki dydaktyczne :
- foliogram przedstawiający model DNA
- foliogram przedstawiający proces replikacji DNA
- podręcznik

3. Metody :
- pogadanka z elementami wykładu
- praca z podręcznikiem
- ćwiczenia – analiza foliogramów
- praktyczne – przygotowywanie modelów DNA

4. Przebieg zajęć :

Faza Czynności nauczyciela Czynności ucznia
WPROWADZAJĄCA - nauczyciel kontroluje wykonanie zadania domowego- nauczyciel wprowadza do nowego tematu lekcji i prosi o zapisanie tematu lekcji - uczeń prezentuje przygotowane zadanie domowe- uczniowie słuchają wprowadzenia i zapisują temat lekcji do zeszytu
REALIZACYJNA - nauczyciel poleca uczniom przeczytanie w podręczniku tekstu odnośnie budowy DNA , na podstawie którego mogą określić :a). Co to jest nukleotyd i z czego jest zbudowanyb) jakie zasady organiczne budują DNAc). Na czym polega komplementarność zasad azotowych- uzupełnia wypowiedzi uczniów i omawia przy pomocy foliogramu cechy budowy DNA - nauczyciel wyjaśnia termin „ replikacja” i przy pomocy foliogramu przedstawiającego proces replikacji DNA omawia mechanizm replikacji- nauczyciel prosi o sformułowanie zwięzłej notatki na temat replikacji DNA - analizując tekst oraz ilustracje w podręczniku uczniowie określają cechy budowy DNA .- uczniowie przy pomocy nauczyciela sporządzają zwięzłą notatkę .- uczniowie formułują krótką notatkę , w której wymieniają zasadnicze etapy procesu replikacji , którą zapisują w zeszytach
PODSUMOWUJĄCA - nauczyciel pyta uczniów , gdzie jest zlokalizowane DNA- nauczyciel podsumowuje lekcję wykorzystując pytania kontrolne , zwraca uwagę uczniów na jednolity typ budowy DNA u wszystkich organizmów - nauczyciel uzupełnia wypowiedzi uczniów .- nauczyciel dzieli klasę na 3 grupy i prosi o wykonanie z papieru modelu DNA (z podanych elementów ). Nauczyciel podaje kolejność nukleotydów .- nauczyciel sprawdza poprawność wykonania modelów DNA . - uczniowie odpowiadają na zadane pytania kontrolne .- uczniowie w grupach wykonują modele DNA. Jako wzoru używają rysunków z podręcznika lub foliogramu .




5. Polecenia kontrolne :
a) Wiedząc , że DNA jest makrocząsteczką , wymień wszystkie rodzaje związków, z których jest zbudowana .
b) Określ , na czym polega komplementarność nici w cząsteczce DNA .
c) Dopisz komplementarną nić do podanej : ATTATTGCTGGTATATAGCCGA
d) Podaj kolejność nukleotydów w łańcuchu DNA komplementarnym do łańcucha ...ATCGCA...


Konspekt zajęć przygotowała
Mgr Grażyna Denicka
Zgłoś błąd    Wyświetleń: 3451


Uwaga! Wszystkie materiały opublikowane na stronach Profesor.pl są chronione prawem autorskim, publikowanie bez pisemnej zgody firmy Edgard zabronione.


BAROMETR


1 2 3 4 5 6  
Oceń artukuł!



Ilość głosów: 0

Serwis internetowy, z którego korzystasz, używa plików cookies. Są to pliki instalowane w urządzeniach końcowych osób korzystających z serwisu, w celu administrowania serwisem, poprawy jakości świadczonych usług w tym dostosowania treści serwisu do preferencji użytkownika, utrzymania sesji użytkownika oraz dla celów statystycznych i targetowania behawioralnego reklamy (dostosowania treści reklamy do Twoich indywidualnych potrzeb). Informujemy, że istnieje możliwość określenia przez użytkownika serwisu warunków przechowywania lub uzyskiwania dostępu do informacji zawartych w plikach cookies za pomocą ustawień przeglądarki lub konfiguracji usługi. Szczegółowe informacje na ten temat dostępne są u producenta przeglądarki, u dostawcy usługi dostępu do Internetu oraz w Polityce prywatności plików cookies.
Dowiedz się więcej.